Illustration about Open book notebook hand drawn cute art painting vector illustration. Illustration of element, diary, studying - 153305094.
In stock
Z23 Carbon-Fiber Ceramic Brake Pads: Upgraded braking performance designed for every-day cars, trucks and SUVs; Dual-Layer Rubberized Shims: Better noise ...
£35.00
1414-131018-153305094. Colour : Ford Spare Parts LimitedTel: 01462 832834 View Map Web Site. £35.00. FORD FIESTA MK7/8. SOLD AS SEEN IN PICS Show More.. FORD ...
Rating
(1,719) · In stock
Decorate and personalize laptops, windows, and more; Removable, kiss-cut vinyl stickers; Super durable and water-resistant; 1/8 inch (3.2mm) white border ...
Vertical Media's phone number is +49 493057707119 What is Vertical Media's official website? Vertical Media's official website is vertical-media.berlin What is ...
RUB 455.00
Гель для наращивания ногтей Color Gel Lobelia 15гр MOOZ 153305094 в интернет-магазине Wildberries. Бесплатная доставка и постоянные скидки!
Find contact information for Vertical Media. Learn about their Manufacturing market share, competitors, and Vertical Media's email format.
... chrX:153305049-153305094. 9484, Early-upstream, CCTGAGAGCTGTTCATTAGTTCTCAAGTCTCAAAATGATTAAACA, Custom made, chrX:153304953-153304998. 9485, Early-upstream ...
$12.82
Erica Nockalls, Noh1. Record Label. Irl. UPC. 5060155721125. eBay Product ID (ePID). 153305094. Product Key Features. Artist. Erica Nockalls. Format. CD.